Skip to main content
Addgene
Open Menu

sABE v3.22 Lenti_2
(Plasmid #209556)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209556 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 209556-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 209556-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    Custom
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9 sgRNA, TadA-8e (2-76)-2xFRB
  • Promoter pU6, pCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sABE v3.22 Lenti_2 was a gift from Xue Gao (Addgene plasmid # 209556 ; http://n2t.net/addgene:209556 ; RRID:Addgene_209556)

  • For your References section:

    A split and inducible adenine base editor for precise in vivo base editing. Zeng H, Yuan Q, Peng F, Ma D, Lingineni A, Chee K, Gilberd P, Osikpa EC, Sun Z, Gao X. Nat Commun. 2023 Sep 11;14(1):5573. doi: 10.1038/s41467-023-41331-5. 10.1038/s41467-023-41331-5 PubMed 37696818
Related items:
Commonly requested with: