Skip to main content

sABE v3.22 Lenti_2
(Plasmid #209556)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209556 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Custom
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9 sgRNA, TadA-8e (2-76)-2xFRB
  • Promoter pU6, pCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sABE v3.22 Lenti_2 was a gift from Xue Gao (Addgene plasmid # 209556 ; http://n2t.net/addgene:209556 ; RRID:Addgene_209556)
  • For your References section:

    A split and inducible adenine base editor for precise in vivo base editing. Zeng H, Yuan Q, Peng F, Ma D, Lingineni A, Chee K, Gilberd P, Osikpa EC, Sun Z, Gao X. Nat Commun. 2023 Sep 11;14(1):5573. doi: 10.1038/s41467-023-41331-5. 10.1038/s41467-023-41331-5 PubMed 37696818