pFlare9A-Clip2E9 WT
(Plasmid
#209574)
-
Purposeminigene construct for Clip2 E9 alternative splicing
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFlare9A
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClip2
-
Alt nameClip1; Cyln2; WSCR4; wbscr4; CLIP-115; mKIAA0291; B230327O20
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1000
-
Entrez GeneClip2 (a.k.a. B230327O20, CLIP-115, Clip1, Cyln2, WSCR4, mKIAA0291, wbscr4)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pflare 593 forward: TAGCGCTACCGGACTCAGAT
- 3′ sequencing primer pflare 1103 reverse: TGGTGCAGATGAACTTCAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFlare9A-Clip2E9 WT was a gift from Sika Zheng (Addgene plasmid # 209574 ; http://n2t.net/addgene:209574 ; RRID:Addgene_209574) -
For your References section:
Axonogenesis Is Coordinated by Neuron-Specific Alternative Splicing Programming and Splicing Regulator PTBP2. Zhang M, Ergin V, Lin L, Stork C, Chen L, Zheng S. Neuron. 2019 Feb 20;101(4):690-706.e10. doi: 10.1016/j.neuron.2019.01.022. Epub 2019 Feb 4. 10.1016/j.neuron.2019.01.022 PubMed 30733148