Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFlare9A-Plekha5E10 WT
(Plasmid #209576)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 209576 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFlare9A
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plekha5
  • Alt name
    Pepp2; AMH-Cre; Ayu21-9; 2810431N21Rik; Gt(pU21)9Imeg; Tg(AMH-cre)1Flor
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    551
  • Entrez Gene
    Plekha5 (a.k.a. 2810431N21Rik, AMH-Cre, Ayu21-9, Gt(pU21)9Imeg, Pepp2, Tg(AMH-cre)1Flor)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pflare 593 forward: TAGCGCTACCGGACTCAGAT
  • 3′ sequencing primer pflare 1103 reverse: TGGTGCAGATGAACTTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFlare9A-Plekha5E10 WT was a gift from Sika Zheng (Addgene plasmid # 209576 ; http://n2t.net/addgene:209576 ; RRID:Addgene_209576)
  • For your References section:

    Axonogenesis Is Coordinated by Neuron-Specific Alternative Splicing Programming and Splicing Regulator PTBP2. Zhang M, Ergin V, Lin L, Stork C, Chen L, Zheng S. Neuron. 2019 Feb 20;101(4):690-706.e10. doi: 10.1016/j.neuron.2019.01.022. Epub 2019 Feb 4. 10.1016/j.neuron.2019.01.022 PubMed 30733148