Skip to main content
Addgene
Open Menu

pFlare9A-Plekha5E10 WT
(Plasmid #209576)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209576 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 209576-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 209576-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pFlare9A
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plekha5
  • Alt name
    Pepp2; AMH-Cre; Ayu21-9; 2810431N21Rik; Gt(pU21)9Imeg; Tg(AMH-cre)1Flor
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    551
  • Entrez Gene
    Plekha5 (a.k.a. 2810431N21Rik, AMH-Cre, Ayu21-9, Gt(pU21)9Imeg, Pepp2, Tg(AMH-cre)1Flor)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pflare 593 forward: TAGCGCTACCGGACTCAGAT
  • 3′ sequencing primer pflare 1103 reverse: TGGTGCAGATGAACTTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFlare9A-Plekha5E10 WT was a gift from Sika Zheng (Addgene plasmid # 209576 ; http://n2t.net/addgene:209576 ; RRID:Addgene_209576)

  • For your References section:

    Axonogenesis Is Coordinated by Neuron-Specific Alternative Splicing Programming and Splicing Regulator PTBP2. Zhang M, Ergin V, Lin L, Stork C, Chen L, Zheng S. Neuron. 2019 Feb 20;101(4):690-706.e10. doi: 10.1016/j.neuron.2019.01.022. Epub 2019 Feb 4. 10.1016/j.neuron.2019.01.022 PubMed 30733148
Related items: