pFlare9A-Plekha5E10 WT
(Plasmid
#209576)
-
Purposeminigene construct for Plekha5 E10 alternative splicing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209576 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFlare9A
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlekha5
-
Alt namePepp2; AMH-Cre; Ayu21-9; 2810431N21Rik; Gt(pU21)9Imeg; Tg(AMH-cre)1Flor
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)551
-
Entrez GenePlekha5 (a.k.a. 2810431N21Rik, AMH-Cre, Ayu21-9, Gt(pU21)9Imeg, Pepp2, Tg(AMH-cre)1Flor)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pflare 593 forward: TAGCGCTACCGGACTCAGAT
- 3′ sequencing primer pflare 1103 reverse: TGGTGCAGATGAACTTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFlare9A-Plekha5E10 WT was a gift from Sika Zheng (Addgene plasmid # 209576 ; http://n2t.net/addgene:209576 ; RRID:Addgene_209576) -
For your References section:
Axonogenesis Is Coordinated by Neuron-Specific Alternative Splicing Programming and Splicing Regulator PTBP2. Zhang M, Ergin V, Lin L, Stork C, Chen L, Zheng S. Neuron. 2019 Feb 20;101(4):690-706.e10. doi: 10.1016/j.neuron.2019.01.022. Epub 2019 Feb 4. 10.1016/j.neuron.2019.01.022 PubMed 30733148