pAAV-C+F-ArchT-GFP
(Plasmid
#209700)
-
PurposeExpresses ArchT-GFP dependent on the combined activity of CRE- and FLP-recombinases
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArchT-GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer ATGGCTGGCAACTAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArchT-GFP from Addgene_28307. Another portion of this plasmid was derived from the Addgene plasmid #11925 (pBS302)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-C+F-ArchT-GFP was a gift from Peer Wulff (Addgene plasmid # 209700 ; http://n2t.net/addgene:209700 ; RRID:Addgene_209700) -
For your References section:
Hippocampal cholecystokinin-expressing interneurons regulate temporal coding and contextual learning. Rangel Guerrero DK, Balueva K, Barayeu U, Baracskay P, Gridchyn I, Nardin M, Roth CN, Wulff P, Csicsvari J. Neuron. 2024 Apr 10:S0896-6273(24)00197-1. doi: 10.1016/j.neuron.2024.03.019. 10.1016/j.neuron.2024.03.019 PubMed 38636524