GOSR2(G144W)-mCherry
(Plasmid
#209887)
-
PurposeExpresses human GOSR2 (GS27) G144W-mutant fused to mChery in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmCherry-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGOSR2
-
Alt nameGS27
-
Alt nameMembrin
-
Alt nameGolgi SNAP receptor complex member 2
-
SpeciesH. sapiens (human)
-
MutationChanged glycine 144 to tryptophan; this mutation causes North Sea progressive myoclonus epilepsy (NSPME)
-
GenBank IDNM_001012511.2
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer CACCTTGAAGCGCATGAACT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned from wildtype GOSR2-mCherry construct
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GOSR2(G144W)-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 209887 ; http://n2t.net/addgene:209887 ; RRID:Addgene_209887)