GOSR2(G144W)-mCherry
(Plasmid
#209887)
-
PurposeExpresses human GOSR2 (GS27) G144W-mutant fused to mChery in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Groningen
Located in Netherlands -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 209887-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 209887-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmCherry-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGOSR2
-
Alt nameGS27
-
Alt nameMembrin
-
Alt nameGolgi SNAP receptor complex member 2
-
SpeciesH. sapiens (human)
-
MutationChanged glycine 144 to tryptophan; this mutation causes North Sea progressive myoclonus epilepsy (NSPME)
-
GenBank IDNM_001012511.2
-
Entrez GeneGOSR2 (a.k.a. Bos1, EPM6, GS27, MYOS)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer CACCTTGAAGCGCATGAACT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned from wildtype GOSR2-mCherry construct
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 209887-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 209887-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GOSR2(G144W)-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 209887 ; http://n2t.net/addgene:209887 ; RRID:Addgene_209887)