lentiCRISPR v2-sgBAK-2
(Plasmid
#210132)
-
Purposeknock out BAK in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 12000
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBcl-2 homologous antagonist/killer
-
Alt nameBAK
-
Alt nameBAK1
-
gRNA/shRNA sequenceGGAACTCTGAGTCATAGCGT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001188.4 NM_001188.4
-
Entrez GeneBAK1 (a.k.a. BAK, BAK-LIKE, BCL2L7, CDN1)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgBAK-2 was a gift from Boyi Gan (Addgene plasmid # 210132 ; http://n2t.net/addgene:210132 ; RRID:Addgene_210132) -
For your References section:
Actin cytoskeleton vulnerability to disulfide stress mediates disulfidptosis. Liu X, Nie L, Zhang Y, Yan Y, Wang C, Colic M, Olszewski K, Horbath A, Chen X, Lei G, Mao C, Wu S, Zhuang L, Poyurovsky MV, James You M, Hart T, Billadeau DD, Chen J, Gan B. Nat Cell Biol. 2023 Mar;25(3):404-414. doi: 10.1038/s41556-023-01091-2. Epub 2023 Feb 6. 10.1038/s41556-023-01091-2 PubMed 36747082