Skip to main content
Addgene

lentiCRISPR v2-sgABI2-2
(Plasmid #210140)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210140 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 12000
  • Total vector size (bp) 12000
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Abl interactor 2
  • Alt name
    ABI2
  • gRNA/shRNA sequence
    TCCAGGCATCCCAGCTACGA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001282925.3
  • Entrez Gene
    ABI2 (a.k.a. ABI-2, ABI2B, AIP-1, AIP1, AblBP3, SSH3BP2, argBP1, argBPIA, argBPIB)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgABI2-2 was a gift from Boyi Gan (Addgene plasmid # 210140 ; http://n2t.net/addgene:210140 ; RRID:Addgene_210140)
  • For your References section:

    Actin cytoskeleton vulnerability to disulfide stress mediates disulfidptosis. Liu X, Nie L, Zhang Y, Yan Y, Wang C, Colic M, Olszewski K, Horbath A, Chen X, Lei G, Mao C, Wu S, Zhuang L, Poyurovsky MV, James You M, Hart T, Billadeau DD, Chen J, Gan B. Nat Cell Biol. 2023 Mar;25(3):404-414. doi: 10.1038/s41556-023-01091-2. Epub 2023 Feb 6. 10.1038/s41556-023-01091-2 PubMed 36747082