pTSAR3.3t
(Plasmid
#210255)
-
PurposeFluorescent reporter for Type III secretion system activity in Shigella flexneri
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUdO1a
-
Backbone manufacturerHost-Microbe Interactions lab
- Total vector size (bp) 3895
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDsRed
-
SpeciesDiscoma sp.
-
Insert Size (bp)678
- Promoter rpsM
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer CTGAATTCAACATTCCAGTGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesuperfolder GFP
-
SpeciesAequorea victoria
-
Insert Size (bp)1564
- Promoter ipaH7.8p
-
Tag
/ Fusion Protein
- ssra (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATTCCATAGAAAACCTCC
- 3′ sequencing primer ACTGGCCGTCGTTTTACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSAR3.3t was a gift from François-Xavier Campbell-Valois (Addgene plasmid # 210255 ; http://n2t.net/addgene:210255 ; RRID:Addgene_210255) -
For your References section:
pUdOs: Concise Plasmids for Bacterial and Mammalian Cells. Manigat FO, Connell LB, Stewart BN, LePabic AR, Tessier CJG, Emlaw JR, Calvert ND, Rossl A, Shuhendler AJ, daCosta CJB, Campbell-Valois FX. ACS Synth Biol. 2024 Jan 18. doi: 10.1021/acssynbio.3c00408. 10.1021/acssynbio.3c00408 PubMed 38235654