PRS_8-jRGECO1a
(Plasmid
#210399)
-
PurposeAAV-vector for fluorescent calcium measurements in the red spectrum from noradrenergic neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 4087
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejRGeco1a
-
SpeciesSynthetic
-
Insert Size (bp)1413
- Promoter PRSx8
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer aacgcgtattagcttccgctag
- 3′ sequencing primer aagcaatagcatgatacaaagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.01.22.477348 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRS_8-jRGECO1a was a gift from Simon Wiegert (Addgene plasmid # 210399 ; http://n2t.net/addgene:210399 ; RRID:Addgene_210399) -
For your References section:
A comparison of viral strategies and model systems to target norepinephrine neurons in the locus coeruleus reveals high variability in transgene expression patterns. Wissing C, Eschholz LS, Maheu M, Sauter K, Morellini F, Wiegert JS, Dieter A. PLoS Biol. 2025 Jul 7;23(7):e3003228. doi: 10.1371/journal.pbio.3003228. eCollection 2025 Jul. 10.1371/journal.pbio.3003228 PubMed 40623068