pOPINVHH_cys_his
(Plasmid
#210403)
-
Purpose(Empty Backbone) For expression of VHH with C-terminal cysteine and his tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepADL-23c
-
Backbone manufacturerAntibody Design Labs
- Backbone size (bp) 3960
-
Modifications to backboneInsertion of LacZalpha and addition of cys - his tag
-
Vector typeBacterial Expression
- Promoter lac
-
Tag
/ Fusion Protein
- cys-his6 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcttccggctcgtatgttg
- 3′ sequencing primer gtcgtctttccagacgttag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINVHH_cys_his was a gift from Ray Owens (Addgene plasmid # 210403 ; http://n2t.net/addgene:210403 ; RRID:Addgene_210403) -
For your References section:
From Llama to Nanobody: A Streamlined Workflow for the Generation of Functionalised VHHs. Eyssen LEA, Ramadurai S, Abdelkarim S, Buckle I, Cornish K, Lin H, Jones AK, Stephens GJ, Owens RJ.. Bio-protocol 14(6): e4962. 10.21769/BioProtoc.4962