Skip to main content

pOPINVHH_sortase_his
(Plasmid #210406)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210406 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pADL-23c
  • Backbone manufacturer
    Antibody Design Labs
  • Backbone size (bp) 3960
  • Modifications to backbone
    Insertion of LacZalpha and addition of C-terminal sortase tag sequence
  • Vector type
    Bacterial Expression
  • Promoter lac
  • Tag / Fusion Protein
    • sortase-his6 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gcttccggctcgtatgttg
  • 3′ sequencing primer gtcgtctttccagacgttag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINVHH_sortase_his was a gift from Ray Owens (Addgene plasmid # 210406 ; http://n2t.net/addgene:210406 ; RRID:Addgene_210406)
  • For your References section:

    From Llama to Nanobody: A Streamlined Workflow for the Generation of Functionalised VHHs. Eyssen LE, Ramadurai S, Abdelkarim S, Buckle I, Cornish K, Lin H, Jones AK, Stephens GJ, Owens RJ. Bio Protoc. 2024 Mar 20;14(6):e4962. doi: 10.21769/BioProtoc.4962. eCollection 2024 Mar 20. 10.21769/BioProtoc.4962 PubMed 38841291