Cas9-T2A-H2B mCitirine
(Plasmid
#210471)
-
PurposeCoexpression of Cas9 and H2B mCitrine
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 2390
- Total vector size (bp) 7867
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-T2A-H2B mCitirine
-
SpeciesH. sapiens (human), Synthetic; Aequorea victoria, streptococcus pyogenes
-
Insert Size (bp)7804
-
MutationCas9 contains 3xFLAG tag and nuclear localization signal
-
Tag
/ Fusion Protein
- mCitrine on C terminal of H2B
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATAAGGGCGACACGGAAATG
- 3′ sequencing primer CTCGCTCACTGACTCGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVectorBuilder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9-T2A-H2B mCitirine was a gift from Amro Hamdoun (Addgene plasmid # 210471 ; http://n2t.net/addgene:210471 ; RRID:Addgene_210471)