Skip to main content

pKB33 (pUC19-KANMX-tetO7-CYCpr)
(Plasmid #210472)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210472 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2790
  • Total vector size (bp) 4934
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KanMX-TetO7-CYCpr cassette
  • Species
    Synthetic
  • Insert Size (bp)
    2144

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cggccagtgaattcgagctc
  • 3′ sequencing primer gcctgcaggtcgactctaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.10.02.560513 for bioRxiv preprint.

The KanMX-tetO7-CYCpr cassette was amplified from the Yeast Tet-Promoters Hughes (yTHC) collection (https://horizondiscovery.com/en/non-mammalian-research-tools/products/yeast-tet-promoters-hughes-ythc)

Ref:
T. R. Hughes et al., Functional discovery via a compendium of expression profiles. Cell. 102(1), 109-126 (7 July 2000).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKB33 (pUC19-KANMX-tetO7-CYCpr) was a gift from Christian Landry (Addgene plasmid # 210472 ; http://n2t.net/addgene:210472 ; RRID:Addgene_210472)
  • For your References section:

    Parallel nonfunctionalization of CK1delta/epsilon kinase ohnologs following a whole-genome duplication event. Evans-Yamamoto D, Dube AK, Saha G, Plante S, Bradley D, Gagnon-Arsenault I, Landry CR. Mol Biol Evol. 2023 Nov 18:msad246. doi: 10.1093/molbev/msad246. 10.1093/molbev/msad246 PubMed 37979156