pKB33 (pUC19-KANMX-tetO7-CYCpr)
(Plasmid
#210472)
-
PurposePlasmid with KanMX-tetO7-CYCpr cassette from the yTHC collection. Used for amplifying cassette with homology to regions of interest for genomic integration.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2790
- Total vector size (bp) 4934
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKanMX-TetO7-CYCpr cassette
-
SpeciesSynthetic
-
Insert Size (bp)2144
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggccagtgaattcgagctc
- 3′ sequencing primer gcctgcaggtcgactctaga
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.10.02.560513 for bioRxiv preprint.
The KanMX-tetO7-CYCpr cassette was amplified from the Yeast Tet-Promoters Hughes (yTHC) collection (https://horizondiscovery.com/en/non-mammalian-research-tools/products/yeast-tet-promoters-hughes-ythc)
Ref:
T. R. Hughes et al., Functional discovery via a compendium of expression profiles. Cell. 102(1), 109-126 (7 July 2000).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKB33 (pUC19-KANMX-tetO7-CYCpr) was a gift from Christian Landry (Addgene plasmid # 210472 ; http://n2t.net/addgene:210472 ; RRID:Addgene_210472) -
For your References section:
Parallel nonfunctionalization of CK1delta/epsilon kinase ohnologs following a whole-genome duplication event. Evans-Yamamoto D, Dube AK, Saha G, Plante S, Bradley D, Gagnon-Arsenault I, Landry CR. Mol Biol Evol. 2023 Nov 18:msad246. doi: 10.1093/molbev/msad246. 10.1093/molbev/msad246 PubMed 37979156