-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepESC-URA
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 6600
-
Vector typeYeast Expression ; yeast/bacteria shuttle
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRnq1
-
Alt nameYCL028W
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1218
-
Entrez GeneRNQ1 (a.k.a. YCL028W)
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATTTTCGGTTTGTATTACTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pESC-URA-Rnq1-GFP was a gift from Judith Frydman (Addgene plasmid # 21051 ; http://n2t.net/addgene:21051 ; RRID:Addgene_21051) -
For your References section:
Misfolded proteins partition between two distinct quality control compartments. Kaganovich D, Kopito R, Frydman J. Nature. 2008 Aug 28. 454(7208):1088-95. 10.1038/nature07195 PubMed 18756251