pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP
(Plasmid
#210513)
-
Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON and SEAP reporter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTet-ONE
- Total vector size (bp) 8175
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesecreted alkaline phosphatase
-
Alt nameSEAP
-
Insert Size (bp)1503
- Promoter TetO
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer caaatgtggtatggc
- 3′ sequencing primer accacttcctaccct (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq
-
Insert Size (bp)3763
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer aggtgataattccacttacgc
- 3′ sequencing primer atggctgattatgatcctctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.21203/rs.3.rs-1628455/v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP was a gift from Dongmin Lee (Addgene plasmid # 210513 ; http://n2t.net/addgene:210513 ; RRID:Addgene_210513) -
For your References section:
A single-component, light-assisted uncaging switch for endoproteolytic release. Cui M, Lee S, Ban SH, Ryu JR, Shen M, Yang SH, Kim JY, Choi SK, Han J, Kim Y, Han K, Lee D, Sun W, Kwon HB, Lee D. Nat Chem Biol. 2024 Mar;20(3):353-364. doi: 10.1038/s41589-023-01480-6. Epub 2023 Nov 16. 10.1038/s41589-023-01480-6 PubMed 37973890