Skip to main content

pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP
(Plasmid #210513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210513 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 210513-D50 50 μg of DNA in Tris buffer $495
DNA 210513-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Tet-ONE
  • Total vector size (bp) 8175
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    secreted alkaline phosphatase
  • Alt name
    SEAP
  • Insert Size (bp)
    1503
  • Promoter TetO

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    CMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq
  • Insert Size (bp)
    3763
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer aggtgataattccacttacgc
  • 3′ sequencing primer atggctgattatgatcctctg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.21203/rs.3.rs-1628455/v1 for preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP was a gift from Dongmin Lee (Addgene plasmid # 210513 ; http://n2t.net/addgene:210513 ; RRID:Addgene_210513)
  • For your References section:

    A single-component, light-assisted uncaging switch for endoproteolytic release. Cui M, Lee S, Ban SH, Ryu JR, Shen M, Yang SH, Kim JY, Choi SK, Han J, Kim Y, Han K, Lee D, Sun W, Kwon HB, Lee D. Nat Chem Biol. 2024 Mar;20(3):353-364. doi: 10.1038/s41589-023-01480-6. Epub 2023 Nov 16. 10.1038/s41589-023-01480-6 PubMed 37973890