pUB_OptλHAramp-FLuc100
(Plasmid
#210577)
-
PurposeExpresses Optimal lambda HA-Optimal Firefly luciferase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUB
- Total vector size (bp) 9812
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOptimal lambda HA-Optimal Firefly luciferase
-
Alt nameFLuc
-
Alt nameFirefly
-
Insert Size (bp)1840
- Promoter UBC human
-
Tag
/ Fusion Protein
- lambda HA (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer UBC_F
- 3′ sequencing primer CGCAAGTTAGGTTTTGTCAAAGAAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOptimal Lambda HA tag synthesized from Genscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUB_OptλHAramp-FLuc100 was a gift from Olivia Rissland (Addgene plasmid # 210577 ; http://n2t.net/addgene:210577 ; RRID:Addgene_210577) -
For your References section:
Synonymous codon usage regulates translation initiation. Barrington CL, Galindo G, Koch AL, Horton ER, Morrison EJ, Tisa S, Stasevich TJ, Rissland OS. Cell Rep. 2023 Dec 26;42(12):113413. doi: 10.1016/j.celrep.2023.113413. Epub 2023 Dec 12. 10.1016/j.celrep.2023.113413 PubMed 38096059