Skip to main content

pSPgRNA_-60_Enh_1
(Plasmid #210621)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210621 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSPgRNA
  • Backbone manufacturer
    Charles Gersbach, Addgene plasmid #47108
  • Backbone size w/o insert (bp) 3223
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAL1 -60 Enhancer gRNA
  • gRNA/shRNA sequence
    gcggagtttagggaaccaga
  • Species
    H. sapiens (human)
  • Entrez Gene
    TAL1 (a.k.a. SCL, TCL5, bHLHa17, tal-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A 4 bp deletion before the gRNA sequence and 5 bp deletion after gRNA sequence was found.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPgRNA_-60_Enh_1 was a gift from Maayan Salton (Addgene plasmid # 210621 ; http://n2t.net/addgene:210621 ; RRID:Addgene_210621)
  • For your References section:

    Isoforms of the TAL1 transcription factor have different roles in hematopoiesis and cell growth. Sharma A, Mistriel-Zerbib S, Najar RA, Engal E, Bentata M, Taqatqa N, Dahan S, Cohen K, Jaffe-Herman S, Geminder O, Baker M, Nevo Y, Plaschkes I, Kay G, Drier Y, Berger M, Salton M. PLoS Biol. 2023 Jun 28;21(6):e3002175. doi: 10.1371/journal.pbio.3002175. 10.1371/journal.pbio.3002175 PubMed 37379322