pSPgRNA_Ex3_4
(Plasmid
#210628)
-
PurposegRNA target sequences for TAL1 Exon 3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210628 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSPgRNA
-
Backbone manufacturerCharles Gersbach, Addgene plasmid #47108
- Backbone size w/o insert (bp) 3223
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAL1 Exon 3 gRNA
-
gRNA/shRNA sequenceCGTCCCGTCCCTCTAGCTGG
-
SpeciesH. sapiens (human)
-
Entrez GeneTAL1 (a.k.a. SCL, TCL5, bHLHa17, tal-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPgRNA_Ex3_4 was a gift from Maayan Salton (Addgene plasmid # 210628 ; http://n2t.net/addgene:210628 ; RRID:Addgene_210628) -
For your References section:
Isoforms of the TAL1 transcription factor have different roles in hematopoiesis and cell growth. Sharma A, Mistriel-Zerbib S, Najar RA, Engal E, Bentata M, Taqatqa N, Dahan S, Cohen K, Jaffe-Herman S, Geminder O, Baker M, Nevo Y, Plaschkes I, Kay G, Drier Y, Berger M, Salton M. PLoS Biol. 2023 Jun 28;21(6):e3002175. doi: 10.1371/journal.pbio.3002175. 10.1371/journal.pbio.3002175 PubMed 37379322