Skip to main content

Tet-pLKO-puro-shTAL1
(Plasmid #210640)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210640 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone manufacturer
    Dmitri Wiederschain, Addgene plasmid #21915
  • Backbone size w/o insert (bp) 10633
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TAL1 3' UTR gRNA
  • gRNA/shRNA sequence
    ACCGGCATAACCACTGAAGGGAATCTCGAGATTCCCTTCAGTGGTTATGTTTTTAATTC
  • Species
    H. sapiens (human)
  • Entrez Gene
    TAL1 (a.k.a. SCL, TCL5, bHLHa17, tal-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoR1 (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tet-pLKO-puro-shTAL1 was a gift from Maayan Salton (Addgene plasmid # 210640 ; http://n2t.net/addgene:210640 ; RRID:Addgene_210640)
  • For your References section:

    Isoforms of the TAL1 transcription factor have different roles in hematopoiesis and cell growth. Sharma A, Mistriel-Zerbib S, Najar RA, Engal E, Bentata M, Taqatqa N, Dahan S, Cohen K, Jaffe-Herman S, Geminder O, Baker M, Nevo Y, Plaschkes I, Kay G, Drier Y, Berger M, Salton M. PLoS Biol. 2023 Jun 28;21(6):e3002175. doi: 10.1371/journal.pbio.3002175. 10.1371/journal.pbio.3002175 PubMed 37379322