pUC57-ITR2-H1-GFP sgRNA Merry Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
(Plasmid
#210742)
-
PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC57
-
Backbone manufacturerGenscript
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSaSp Cas9
-
SpeciesSynthetic
-
MutationN-terminal Sa Cas9, C-terminal Sp Cas9
- Promoter eCMV
-
Tag
/ Fusion Protein
- 3xFLAG, SV40 NLS, PolyA signal (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer n/a (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMerry sgRNA GFP Target 2
-
Alt namegRNA target: GATGCCGTTCTTCTGCTTGTGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGAACTTGAAAAAGTGT
-
SpeciesSynthetic
- Promoter H1
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57-ITR2-H1-GFP sgRNA Merry Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2 was a gift from Vincent Dion (Addgene plasmid # 210742 ; http://n2t.net/addgene:210742 ; RRID:Addgene_210742)