Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC57-ITR2-H1-GFP sgRNA Merry Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
(Plasmid #210744)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 210744 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC57
  • Backbone manufacturer
    Genscript
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SaSp Cas9
  • Species
    Synthetic
  • Mutation
    N-terminal Sa Cas9, C-terminal Sp Cas9
  • Promoter eCMV
  • Tag / Fusion Protein
    • 3xFLAG, SV40 NLS, PolyA signal (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Merry sgRNA GFP Target 4
  • Alt name
    gRNA target: GGGCGAGGAGCTGTTCACCGGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGAACTTGAAAAAGTGT
  • Species
    Synthetic
  • Promoter H1

Cloning Information for Gene/Insert 2

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC57-ITR2-H1-GFP sgRNA Merry Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2 was a gift from Vincent Dion (Addgene plasmid # 210744 ; http://n2t.net/addgene:210744 ; RRID:Addgene_210744)