pGMC00033 (aka pMC0224)
(Plasmid
#210750)
-
PurposeGuide RNA targeting SERPINB3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGMC00009 (SpCas9-2A-GFP-2A-Puro)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSERBPINB3 guide RNA
-
gRNA/shRNA sequenceGAACAGGTCGAACATGAACT
-
SpeciesH. sapiens (human)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMC00033 (aka pMC0224) was a gift from Raj Chari (Addgene plasmid # 210750 ; http://n2t.net/addgene:210750 ; RRID:Addgene_210750) -
For your References section:
SERPINB3-MYC axis induces the basal-like/squamous subtype and enhances disease progression in pancreatic cancer. Ohara Y, Tang W, Liu H, Yang S, Dorsey TH, Cawley H, Moreno P, Chari R, Guest MR, Azizian A, Gaedcke J, Ghadimi M, Hanna N, Ambs S, Hussain SP. Cell Rep. 2023 Nov 18;42(12):113434. doi: 10.1016/j.celrep.2023.113434. 10.1016/j.celrep.2023.113434 PubMed 37980563