pCambia3301-AtU6-MAR1
(Plasmid
#210757)
-
PurposeMutagenesis of the Arabidopsis MAR1 gene for efficient screening.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCambia3301
-
Vector typePlant Expression, CRISPR
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAtU6-26 pro::MAR1 sgRNA
-
gRNA/shRNA sequenceCTGGAGTTCTGGACCGTCCT
-
SpeciesA. thaliana (mustard weed)
- Promoter AtU6-26
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCambia3301-AtU6-MAR1 was a gift from Daisuke Miki (Addgene plasmid # 210757 ; http://n2t.net/addgene:210757 ; RRID:Addgene_210757) -
For your References section:
Double step screening using endogenous marker improves relative gene targeting efficiency in Arabidopsis. Cheng Y, Zhang L, Ke Y, Dang X, Miki D. Sci Rep. 2024 Dec 28;14(1):30791. doi: 10.1038/s41598-024-80352-y. 10.1038/s41598-024-80352-y PubMed 39730554