pkk223_TtMutY_F305A_S306A_H307A
(Plasmid
#210793)
-
Purposepkk223 with Thiotrichaceae MutY containing F305A, S306A, and H307A mutations to reduce recognition of OG:A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepkk223
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMutY (adenine glycosylase)
-
SpeciesThiotrichaceae (family)
-
MutationF305A_S306A_H307A
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gttttttgcgccgacatcataacggttc
- 3′ sequencing primer gcttctgcgttctgatttaatctgtatcaggctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.04.05.535768v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pkk223_TtMutY_F305A_S306A_H307A was a gift from Martin Horvath (Addgene plasmid # 210793 ; http://n2t.net/addgene:210793 ; RRID:Addgene_210793) -
For your References section:
Metagenome mining and functional analysis reveal oxidized guanine DNA repair at the Lost City Hydrothermal Field. Utzman PH, Mays VP, Miller BC, Fairbanks MC, Brazelton WJ, Horvath MP. PLoS One. 2024 May 8;19(5):e0284642. doi: 10.1371/journal.pone.0284642. eCollection 2024. 10.1371/journal.pone.0284642 PubMed 38718041