Skip to main content

APCDD1-P2A-tdTomato
(Plasmid #210801)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210801 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pl552
  • Backbone size w/o insert (bp) 5293
  • Total vector size (bp) 8707
  • Modifications to backbone
    the P2A-tdtomato-hGHPA sequence, flancked by APCDD1 left arm and right arm was inserted into the vector
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APCDD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3900
  • Entrez Gene
    APCDD1 (a.k.a. B7323, DRAPC1, FP7019, HHS, HTS, HYPT1)
  • Promoter endougeneous APCDD1 promoter
  • Tag / Fusion Protein
    • tdtomato (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer accatgattacgccaagctc
  • 3′ sequencing primer attcactggccgtcgtttta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    APCDD1-P2A-tdTomato was a gift from Yuejun Chen (Addgene plasmid # 210801 ; http://n2t.net/addgene:210801 ; RRID:Addgene_210801)
  • For your References section:

    Mapping of clonal lineages across developmental stages in human neural differentiation. You Z, Wang L, He H, Wu Z, Zhang X, Xue S, Xu P, Hong Y, Xiong M, Wei W, Chen Y. Cell Stem Cell. 2023 Apr 6;30(4):473-487.e9. doi: 10.1016/j.stem.2023.02.007. Epub 2023 Mar 17. 10.1016/j.stem.2023.02.007 PubMed 36933556