pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
(Plasmid
#210820)
-
PurposeMammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2
-
Backbone manufacturerNathan D. Lawson
- Backbone size w/o insert (bp) 4736
- Total vector size (bp) 10226
-
Modifications to backboneIRES2 site added between upstream of the second insert to convert pCS2 into a polycistronic duet vector.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameProminin 1
-
Alt namePROM1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2745
-
Entrez GenePROM1 (a.k.a. AC133, CD133, CORD12, MCDR2, MSTP061, PROML1, RP41, STGD4)
- Promoter CMV
-
Tag
/ Fusion Protein
- TwinStrep, 10xHis (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameProtocadherin 21
-
Alt namePCDH21
-
Alt nameCadherin-related family member 1
-
Alt nameCDHR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2745
-
Entrez GeneCDHR1 (a.k.a. CORD15, PCDH21, PRCAD, RP65)
- Promoter CMV / IRES2
-
Tag
/ Fusion Protein
- Myc, 3xFlag (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTGTTTAGTCGAGGTTAAAAAAACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byModified version of construct from Noriaki Sasai (Nara Institute of Science and Technology).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.
Original construct published in: Hori, A., Nishide, K., Yasukuni, Y., Haga, K., Kakuta, W., Ishikawa, Y., Hayes, M.J., Ohnuma, S., Kiyonari, H., Kimura, K., et al. (2019). Prominin-1 Modulates Rho/ROCK-Mediated Membrane Morphology and Calcium-Dependent Intracellular Chloride Flux. Sci. Rep. 9, 15911. 10.1038/s41598-019-52040-9.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag was a gift from Luke Chao (Addgene plasmid # 210820 ; http://n2t.net/addgene:210820 ; RRID:Addgene_210820) -
For your References section:
Prominin 1 and Tweety Homology 1 both induce extracellular vesicle formation. Bell TA, Luce BE, Hakim P, Ananda VY, Dardari H, Nguyen TH, Monshizadeh A, Chao LH. Elife. 2024 Aug 13;13:e100061. doi: 10.7554/eLife.100061. 10.7554/eLife.100061 PubMed 39168849