pJTM-T7-mNeongreen-6xHis
(Plasmid
#210868)
-
PurposePlasmid used for expressing his--tagged mNeongreen for protein purification.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemNeongreen-6xHistag
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTAACTTTAAGAAGGAGATATAATGGTCTCCAAGGGCGAGG
- 3′ sequencing primer TTTTTTGGCTGAATTAATGGTGATGGTGATGGTGCTTATAGAGCTCATCCATCCCCATCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJTM-T7-mNeongreen-6xHis was a gift from Richard Murray (Addgene plasmid # 210868 ; http://n2t.net/addgene:210868 ; RRID:Addgene_210868) -
For your References section:
Development of Cell-Free Transcription-Translation Systems in Three Soil Pseudomonads. Meyerowitz JT, Larsson EM, Murray RM. ACS Synth Biol. 2024 Feb 16;13(2):530-537. doi: 10.1021/acssynbio.3c00468. Epub 2024 Feb 6. 10.1021/acssynbio.3c00468 PubMed 38319019