pUC19-Top2A-5X Gly-Venus-T2A-Hygro
(Plasmid #211115)

• Purpose: For tagging the C-term of Top2A with Venus
• Depositing Lab: Job Dekker
• Depositing Organization: University of Massachusetts, Worcester
  Located in the United States of America
• Publication: Hildebrand et al Mol Cell. 2024 Mar 13:S1097-2765(24)00144-8. doi: 10.1016/j.molcel.2024.02.025.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: ThermoFisher
• Backbone size w/o insert (bp): 2686
• Total vector size (bp): 6562
• Modifications to backbone: none
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 5' C-term Top2A homology arm
• Species: H. sapiens (human)
• Insert Size (bp): 800
• GenBank ID: NG_027678.1
• Entrez Gene: TOP2A (a.k.a. TOP2, TOP2alpha, TOPIIA, TP2A)
• Promoter: n/a

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aacaattcatctaagagtgg

Gene/Insert 2

• Gene/Insert name: Venus
• Species: Aequorea victoria
• Insert Size (bp): 720
• Promoter: n/a

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGGTGAGCAAGGGCGAGGA

Gene/Insert 3

• Gene/Insert name: T2A
• Species: Synthetic
• Insert Size (bp): 57
• Promoter: n/a

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGGCAGAGGAAGTCTGCT

Gene/Insert 4

• Gene/Insert name: Blastocidin Resistance
• Species: Bacillus cereus
• Insert Size (bp): 987
• Promoter: n/a

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGAAAAAGCCTGAACTCAC

Gene/Insert 5

• Gene/Insert name: 5' C-term Top2A homology arm
• Species: H. sapiens (human)
• Insert Size (bp): 800
• GenBank ID: NG_027678.1
• Entrez Gene: TOP2A (a.k.a. TOP2, TOP2alpha, TOPIIA, TP2A)
• Promoter: n/a

Cloning Information for Gene/Insert 5

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAAAATGTGAGGCGATTATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 211115-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 211115-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.