Skip to main content
Addgene

pBiT3.1-C_WDR25:1-544
(Plasmid #211325)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211325 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBiT3.1-C
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    WDR25:M1-H544
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1632
  • Mutation
    wild type
  • Entrez Gene
    WDR25 (a.k.a. MGC4645)
  • Promoter CMV
  • Tag / Fusion Protein
    • GSSGGSSGVSGWRLFKKIS (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7
  • 3′ sequencing primer TTGCTCAGCGGTGGCAGCAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Integrated DNA Technologies (Synthetic dsDNA)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: EcoR1 (not destroyed), 3' Cloning Site: Xho1 (not destroyed).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBiT3.1-C_WDR25:1-544 was a gift from Cheryl Arrowsmith (Addgene plasmid # 211325 ; http://n2t.net/addgene:211325 ; RRID:Addgene_211325)

  • For your References section:

    A Target Class Ligandability Evaluation of WD40 Repeat-Containing Proteins. Ackloo S, Li F, Szewczyk M, Seitova A, Loppnau P, Zeng H, Xu J, Ahmad S, Arnautova YA, Baghaie AJ, Beldar S, Bolotokova A, Centrella PA, Chau I, Clark MA, Cuozzo JW, Dehghani-Tafti S, Disch JS, Dong A, Dumas A, Feng JA, Ghiabi P, Gibson E, Gilmer J, Goldman B, Green SR, Guie MA, Guilinger JP, Harms N, Herasymenko O, Houliston S, Hutchinson A, Kearnes S, Keefe AD, Kimani SW, Kramer T, Kutera M, Kwak HA, Lento C, Li Y, Liu J, Loup J, Machado RAC, Mulhern CJ, Perveen S, Righetto GL, Riley P, Shrestha S, Sigel EA, Silva M, Sintchak MD, Slakman BL, Taylor RD, Thompson J, Torng W, Underkoffler C, von Rechenberg M, Walsh RT, Watson I, Wilson DJ, Wolf E, Yadav M, Yazdi AK, Zhang J, Zhang Y, Santhakumar V, Edwards AM, Barsyte-Lovejoy D, Schapira M, Brown PJ, Halabelian L, Arrowsmith CH. J Med Chem. 2025 Jan 23;68(2):1092-1112. doi: 10.1021/acs.jmedchem.4c02010. Epub 2024 Nov 4. 10.1021/acs.jmedchem.4c02010 PubMed 39495097
Related items: