AAVS-HsProm1s1(W795R)-StayGold
(Plasmid
#211334)
-
PurposeVector for stable mammalian gene editing with C-terminally StayGold tagged human Prom1s1 (W795R)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAVS1
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 9001
- Total vector size (bp) 12262
-
Vector typeAAV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProminin 1
-
Alt namePROM1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3261
-
MutationChanged Trp-795 to Arg
-
Entrez GenePROM1 (a.k.a. AC133, CD133, CORD12, MCDR2, MSTP061, PROML1, RP41, STGD4)
- Promoter EF1a
-
Tag
/ Fusion Protein
- StayGold (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer accgtatataagtgcagtagtcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.08.566258 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS-HsProm1s1(W795R)-StayGold was a gift from Luke Chao (Addgene plasmid # 211334 ; http://n2t.net/addgene:211334 ; RRID:Addgene_211334) -
For your References section:
Prominin 1 and Tweety Homology 1 both induce extracellular vesicle formation. Bell TA, Luce BE, Hakim P, Ananda VY, Dardari H, Nguyen TH, Monshizadeh A, Chao LH. Elife. 2024 Aug 13;13:e100061. doi: 10.7554/eLife.100061. 10.7554/eLife.100061 PubMed 39168849