m.3075-Left TALE-G1397-N-dead-mCherry
(Plasmid
#211340)
-
PurposeExpression of codon-optimized dead mitochondrial base editor in human cells; cell sorting; blasticidin drug selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression, TALEN
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsLower temperature is preferred
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namem.3075-Left TALE-G1397-N-dead-mCherry
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3450
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gacccaagctggctagcacc
- 3′ sequencing primer cagaggacaaagacccctta
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
m.3075-Left TALE-G1397-N-dead-mCherry was a gift from Monkol Lek (Addgene plasmid # 211340 ; http://n2t.net/addgene:211340 ; RRID:Addgene_211340)