pLJC5 mScarlet-FAM98B
(Plasmid
#211350)
-
PurposeConstitutive lentiviral expression of V5-mScarlet-FAM98B fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLJC5
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameV5-mScarlet-FAM98B
-
SpeciesH. sapiens (human)
-
Entrez GeneFAM98B
- Promoter Ubc
-
Tags
/ Fusion Proteins
- V5 (N terminal on insert)
- mScarlet (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAAGGAATAGAAGAAGAAGGTGGAGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJC5 mScarlet-FAM98B was a gift from Raghu Chivukula (Addgene plasmid # 211350 ; http://n2t.net/addgene:211350 ; RRID:Addgene_211350) -
For your References section:
Polyglycine-mediated aggregation of FAM98B disrupts tRNA processing in GGC repeat disorders. Yang J, Xu Y, Ziehr DR, Taylor MS, Valenstein ML, Frenkel EM, Bush JR, Rutter K, Stevanovski I, Shi CY, Kesavan M, Pinto RM, Deveson I, Bartel DP, Sabatini DM, Chivukula RR. Science. 2025 Jul 17;389(6757):eado2403. doi: 10.1126/science.ado2403. Epub 2025 Jul 17. 10.1126/science.ado2403 PubMed 40674500