TLCV2-ApaLI-FLAG-T2A-mTagBFP2-Puro
(Plasmid
#211462)
-
PurposeLentivirus backbone expressing a doxycycline-inducible mitochondrial localized ApaLI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTLCV2
- Backbone size w/o insert (bp) 10362
- Total vector size (bp) 11626
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameApaLI
-
Insert Size (bp)1264
- Promoter TRE
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer ccgtcagatcgcctggagaat
- 3′ sequencing primer TCCACTGCCGGATCcaGGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2-ApaLI-FLAG-T2A-mTagBFP2-Puro was a gift from Agnel Sfeir (Addgene plasmid # 211462 ; http://n2t.net/addgene:211462 ; RRID:Addgene_211462) -
For your References section:
Mitochondrial DNA breaks activate an integrated stress response to reestablish homeostasis. Fu Y, Sacco O, DeBitetto E, Kanshin E, Ueberheide B, Sfeir A. Mol Cell. 2023 Oct 8:S1097-2765(23)00753-0. doi: 10.1016/j.molcel.2023.09.026. 10.1016/j.molcel.2023.09.026 PubMed 37832546