PB-PARP1-Apex2–eGFP
(Plasmid
#211555)
-
PurposeA piggyBac vector containing CMV-PARP1-Apex2-eGFP-IRES-Neo cassette.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonecustom
-
Vector typeMammalian Expression ; PiggyBac
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePARP1
-
SpeciesH. sapiens (human)
-
Entrez GenePARP1 (a.k.a. ADPRT, ADPRT 1, ADPRT1, ARTD1, PARP, PARP-1, PARS, PPOL, Poly-PARP, pADPRT-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- Apex2-eGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-PARP1-Apex2–eGFP was a gift from Chris Lord (Addgene plasmid # 211555 ; http://n2t.net/addgene:211555 ; RRID:Addgene_211555) -
For your References section:
The ubiquitin-dependent ATPase p97 removes cytotoxic trapped PARP1 from chromatin. Krastev DB, Li S, Sun Y, Wicks AJ, Hoslett G, Weekes D, Badder LM, Knight EG, Marlow R, Pardo MC, Yu L, Talele TT, Bartek J, Choudhary JS, Pommier Y, Pettitt SJ, Tutt ANJ, Ramadan K, Lord CJ. Nat Cell Biol. 2022 Jan;24(1):62-73. doi: 10.1038/s41556-021-00807-6. Epub 2022 Jan 10. 10.1038/s41556-021-00807-6 PubMed 35013556