Skip to main content

peMBD2mRFP (pc2389)
(Plasmid #211573)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211573 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmRFP-N2
  • Total vector size (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MBD2
  • Alt name
    Mus musculus methyl-CpG binding domain protein 2
  • Species
    M. musculus (mouse)
  • Promoter CMV
  • Tag / Fusion Protein
    • RFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GTGTTGCTCCTGATGTGGTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    peMBD2mRFP (pc2389) was a gift from Cristina Cardoso (Addgene plasmid # 211573 ; http://n2t.net/addgene:211573 ; RRID:Addgene_211573)
  • For your References section:

    Direct homo- and hetero-interactions of MeCP2 and MBD2. Becker A, Allmann L, Hofstatter M, Casa V, Weber P, Lehmkuhl A, Herce HD, Cardoso MC. PLoS One. 2013;8(1):e53730. doi: 10.1371/journal.pone.0053730. Epub 2013 Jan 15. 10.1371/journal.pone.0053730 PubMed 23335972