Skip to main content

pMeCP2R.9 (pc2812)
(Plasmid #211574)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211574 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmRFP-N2
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MeCP2 aa163-309
  • Species
    R. norvegicus (rat)
  • Promoter CMV
  • Tag / Fusion Protein
    • RFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GTGTTGCTCCTGATGTGGTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMeCP2R.9 (pc2812) was a gift from Cristina Cardoso (Addgene plasmid # 211574 ; http://n2t.net/addgene:211574 ; RRID:Addgene_211574)
  • For your References section:

    Direct homo- and hetero-interactions of MeCP2 and MBD2. Becker A, Allmann L, Hofstatter M, Casa V, Weber P, Lehmkuhl A, Herce HD, Cardoso MC. PLoS One. 2013;8(1):e53730. doi: 10.1371/journal.pone.0053730. Epub 2013 Jan 15. 10.1371/journal.pone.0053730 PubMed 23335972