pFB-MBD2.1mR (pc2391)
(Plasmid
#211723)
-
PurposeExpresses MBD2 (aa1-152) RFP tagged in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4472
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMBD2.1 aa1-152
-
Alt nameMus musculus methyl-CpG binding domain protein 2
-
SpeciesM. musculus (mouse)
- Promoter Polyhedrin promotor
-
Tag
/ Fusion Protein
- RFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PspOMI (not destroyed)
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer GTGTTGCTCCTGATGTGGTAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-MBD2.1mR (pc2391) was a gift from Cristina Cardoso (Addgene plasmid # 211723 ; http://n2t.net/addgene:211723 ; RRID:Addgene_211723) -
For your References section:
Direct homo- and hetero-interactions of MeCP2 and MBD2. Becker A, Allmann L, Hofstatter M, Casa V, Weber P, Lehmkuhl A, Herce HD, Cardoso MC. PLoS One. 2013;8(1):e53730. doi: 10.1371/journal.pone.0053730. Epub 2013 Jan 15. 10.1371/journal.pone.0053730 PubMed 23335972