px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
(Plasmid
#211760)
-
PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepx552
-
Backbone manufacturer(Addgene #60958)
-
Modifications to backboneReplaced the human synapsin (hSyn) promotor with a ubiquitous CMV promotor to drive GFP expression
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA1 and gRNA2 targeting VEGF-A
-
SpeciesH. sapiens (human), M. musculus (mouse); M. mulatta (rhesus macaque)
-
GenBank IDENSMMUG00000004577
-
Entrez GeneVEGFA (a.k.a. L-VEGF, MVCD1, VEGF, VPF)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (unknown if destroyed)
- 3′ cloning site SapI (unknown if destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP was a gift from Glenn Yiu (Addgene plasmid # 211760 ; http://n2t.net/addgene:211760 ; RRID:Addgene_211760) -
For your References section:
CRISPR-based VEGF suppression using paired guide RNAs for treatment of choroidal neovascularization. Chung SH, Sin TN, Dang B, Ngo T, Lo T, Lent-Schochet D, Meleppat RK, Zawadzki RJ, Yiu G. Mol Ther Nucleic Acids. 2022 Apr 27;28:613-622. doi: 10.1016/j.omtn.2022.04.015. eCollection 2022 Jun 14. 10.1016/j.omtn.2022.04.015 PubMed 35614998