Skip to main content

pAAV2-Sst44-mTagBFP2
(Plasmid #211807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211807 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTagBFP2
  • Species
    Entacmaea quadricolor
  • Insert Size (bp)
    708
  • Promoter Sst44 enhancer, modified CMV promoter
  • Tag / Fusion Protein
    • NLS, FLAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCGACGTATAAGCTTTAGGCG
  • 3′ sequencing primer caatctttcacaaattttgtaatccagagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV2-Sst44-mTagBFP2 was a gift from Christopher Harvey (Addgene plasmid # 211807 ; http://n2t.net/addgene:211807 ; RRID:Addgene_211807)
  • For your References section:

    A cell-type-specific error-correction signal in the posterior parietal cortex. Green J, Bruno CA, Traunmuller L, Ding J, Hrvatin S, Wilson DE, Khodadad T, Samuels J, Greenberg ME, Harvey CD. Nature. 2023 Aug;620(7973):366-373. doi: 10.1038/s41586-023-06357-1. Epub 2023 Jul 19. 10.1038/s41586-023-06357-1 PubMed 37468637