pAAV hSyn RSET-T-GECO1.WPRE
(Plasmid
#211902)
-
PurposeExpresses T-GECO1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV hSyn
- Backbone size w/o insert (bp) 4290
- Total vector size (bp) 5628
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT-GECO1
-
Alt nameT-GECO
-
Alt nameTGECO
-
SpeciesSynthetic
-
Insert Size (bp)1338
- Promoter hSyn
-
Tag
/ Fusion Protein
- RSET peptide (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtttgtacaaaaaagcaggc
- 3′ sequencing primer aattcccactttgtacaag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn RSET-T-GECO1.WPRE was a gift from Robert Campbell (Addgene plasmid # 211902 ; http://n2t.net/addgene:211902 ; RRID:Addgene_211902) -
For your References section:
Blue-shifted genetically encoded Ca(2+) indicator with enhanced two-photon absorption. Aggarwal A, Sunil S, Bendifallah I, Moon M, Drobizhev M, Zarowny L, Zheng J, Wu SY, Lohman AW, Tebo AG, Emiliani V, Podgorski K, Shen Y, Campbell RE. Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117/1.NPh.11.2.024207. 10.1117/1.NPh.11.2.024207 PubMed 38577628