-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLZRS-RfA
- Backbone size w/o insert (bp) 11100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsSTBL2
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMek1
-
Alt nameMAP2K1
-
Alt nameER-{alpha}
-
Alt nameEsr1
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)2200
-
MutationMek1 R4F fused to ER*, constitutive active
-
Entrez GeneEsr1 (a.k.a. ER, ER-alpha, ERa, ERalpha, ESR, Estr, Estra, Nr3a1)
-
Entrez GeneMAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site attR (not destroyed)
- 3′ cloning site attR (not destroyed)
- 5′ sequencing primer TGGATACACGCCGCCCACGTG
- 3′ sequencing primer ATCGTCGACCACTGTGCTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L1E-1 was a gift from Paul Khavari (Addgene plasmid # 21193 ; http://n2t.net/addgene:21193 ; RRID:Addgene_21193) -
For your References section:
Mek1 alters epidermal growth and differentiation. Scholl FA, Dumesic PA, Khavari PA. Cancer Res. 2004 Sep 1;64(17):6035-40 10.1158/0008-5472.CAN-04-0017 PubMed 15342384