Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #21193)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 21193 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 11100
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    Mek1 R4F fused to ER*, constitutive active
  • Entrez Gene
    Esr1 (a.k.a. ER, ER-alpha, ERa, ERalpha, ESR, Estr, Estra, Nr3a1)
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MKK1, PRKMK1)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR (not destroyed)
  • 3′ cloning site attR (not destroyed)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    L1E-1 was a gift from Paul Khavari (Addgene plasmid # 21193 ; ; RRID:Addgene_21193)
  • For your References section:

    Mek1 alters epidermal growth and differentiation. Scholl FA, Dumesic PA, Khavari PA. Cancer Res. 2004 Sep 1;64(17):6035-40 10.1158/0008-5472.CAN-04-0017 PubMed 15342384