Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

L1E-1
(Plasmid #21193)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21193 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LZRS-RfA
  • Backbone size w/o insert (bp) 11100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    STBL2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Mek1
  • Alt name
    MAP2K1
  • Alt name
    ER-{alpha}
  • Alt name
    Esr1
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    2200
  • Mutation
    Mek1 R4F fused to ER*, constitutive active
  • Entrez Gene
    Esr1 (a.k.a. ER, ER-alpha, ERa, ERalpha, ESR, Estr, Estra, Nr3a1)
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR (not destroyed)
  • 3′ cloning site attR (not destroyed)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    L1E-1 was a gift from Paul Khavari (Addgene plasmid # 21193 ; http://n2t.net/addgene:21193 ; RRID:Addgene_21193)
  • For your References section:

    Mek1 alters epidermal growth and differentiation. Scholl FA, Dumesic PA, Khavari PA. Cancer Res. 2004 Sep 1;64(17):6035-40 10.1158/0008-5472.CAN-04-0017 PubMed 15342384