Talin1(ΔR1-10)-mCherry
(Plasmid
#212007)
-
PurposeExpression of mouse talin1 (1-490 + 1974-2541)-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3962
- Total vector size (bp) 7847
-
Modifications to backboneN-terminal EGFP removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTalin1(ΔR1-10)-mCherry
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3885
-
GenBank IDCAA39588.1
-
Entrez GeneTln1 (a.k.a. Tln)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry fluorescent protein (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgcaaatgggcggtagg
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Talin1(ΔR1-10)-mCherry was a gift from Vesa Hytönen (Addgene plasmid # 212007 ; http://n2t.net/addgene:212007 ; RRID:Addgene_212007) -
For your References section:
Talin-mediated force transmission and talin rod domain unfolding independently regulate adhesion signaling. Rahikainen R, Ohman T, Turkki P, Varjosalo M, Hytonen VP. J Cell Sci. 2019 Apr 3;132(7):jcs226514. doi: 10.1242/jcs.226514. 10.1242/jcs.226514 PubMed 30837291