Skip to main content
Addgene

pCOLA-Spec-yibDp-Erv1p
(Plasmid #212094)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212094 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCOLA-Spec-EV (Addgene #212095)
  • Backbone size w/o insert (bp) 1900
  • Total vector size (bp) 2693
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Sulfydryl oxidase
  • Alt name
    Erv1p
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    573
  • Entrez Gene
    ERV1 (a.k.a. YGR029W)
  • Promoter yibDp

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGCGTAATTGTGCTGATCTCTT
  • 3′ sequencing primer AAGTTGGAACCTCTTACGTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see our protocol for more information on using these plasmids: Two-Stage Dynamic Control Protocol for Cloning, Autoinduction, Autolysis, and Purification of Nanobodies from the E. coli Cytoplasm dx.doi.org/10.17504/protocols.io.j8nlk95d1v5r/v1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCOLA-Spec-yibDp-Erv1p was a gift from Michael Lynch (Addgene plasmid # 212094 ; http://n2t.net/addgene:212094 ; RRID:Addgene_212094)
  • For your References section:

    Scalable, robust, high-throughput expression & purification of nanobodies enabled by 2-stage dynamic control. Hennigan JN, Menacho-Melgar R, Sarkar P, Golovsky M, Lynch MD. Metab Eng. 2024 Sep;85:116-130. doi: 10.1016/j.ymben.2024.07.012. Epub 2024 Jul 24. 10.1016/j.ymben.2024.07.012 PubMed 39059674