pCOLA-Spec-yibDp-Erv1p
(Plasmid
#212094)
-
PurposeExpresses sulfydryl oxidase (Erv1p) after phosphate depletion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCOLA-Spec-EV (Addgene #212095)
- Backbone size w/o insert (bp) 1900
- Total vector size (bp) 2693
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSulfydryl oxidase
-
Alt nameErv1p
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)573
-
Entrez GeneERV1 (a.k.a. YGR029W)
- Promoter yibDp
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGCGTAATTGTGCTGATCTCTT
- 3′ sequencing primer AAGTTGGAACCTCTTACGTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see our protocol for more information on using these plasmids: Two-Stage Dynamic Control Protocol for Cloning, Autoinduction, Autolysis, and Purification of Nanobodies from the E. coli Cytoplasm dx.doi.org/10.17504/protocols.io.j8nlk95d1v5r/v1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCOLA-Spec-yibDp-Erv1p was a gift from Michael Lynch (Addgene plasmid # 212094 ; http://n2t.net/addgene:212094 ; RRID:Addgene_212094) -
For your References section:
Scalable, robust, high-throughput expression & purification of nanobodies enabled by 2-stage dynamic control. Hennigan JN, Menacho-Melgar R, Sarkar P, Golovsky M, Lynch MD. Metab Eng. 2024 Sep;85:116-130. doi: 10.1016/j.ymben.2024.07.012. Epub 2024 Jul 24. 10.1016/j.ymben.2024.07.012 PubMed 39059674