pcDNA5/FRT/TO mTagBFP2-GABARAP(G116A)-GABARAP
(Plasmid
#212109)
-
PurposeExpression of N-terminally tagged GABARAP tandem construct with mTagBFP2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5049
- Total vector size (bp) 6510
-
Modifications to backbonePart of MCS removed (TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGA), --> PmeI site followed by PspOMI site (TTTAAACGGGCCC), second PmeI site removed (gt --> ac) downstream of ApaI site
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTagBFP2-GABARAP(G116A)-GABARAP
-
SpeciesH. sapiens (human); Entacmaea quadricolor
-
Insert Size (bp)1461
-
Entrez GeneGABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
- Promoter CMV
-
Tag
/ Fusion Protein
- mTagBFP2 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CMV-fw
- 3′ sequencing primer bGH-rev* (GACACCTACTCAGACAATGCG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO mTagBFP2-GABARAP(G116A)-GABARAP was a gift from Dieter Willbold (Addgene plasmid # 212109 ; http://n2t.net/addgene:212109 ; RRID:Addgene_212109) -
For your References section:
Highlighting the hidden: monitoring the avidity-driven association of a fluorescent GABARAP tandem with microtubules in living cells. Üffing A, Gold L, Gensch T, Weiergräber OH, Hoffmann S, Willbold D. Autophagy Reports, 3(1). doi: 10.1080/27694127.2024.2348899 10.1080/27694127.2024.2348899