Skip to main content

pcDNA5/FRT/TO mTagBFP2-GABARAP
(Plasmid #212110)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212110 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5049
  • Total vector size (bp) 6135
  • Modifications to backbone
    Part of MCS removed (TTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGA), --> PmeI site followed by PspOMI site (TTTAAACGGGCCC), second PmeI site removed (gt --> ac) downstream of ApaI site
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTagBFP2-GABARAP
  • Species
    H. sapiens (human); Entacmaea quadricolor
  • Insert Size (bp)
    1086
  • Entrez Gene
    GABARAP (a.k.a. ATG8A, GABARAP-a, MM46)
  • Promoter CMV
  • Tag / Fusion Protein
    • mTagBFP2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-fw
  • 3′ sequencing primer bGH-rev* (GACACCTACTCAGACAATGCG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO mTagBFP2-GABARAP was a gift from Dieter Willbold (Addgene plasmid # 212110 ; http://n2t.net/addgene:212110 ; RRID:Addgene_212110)
  • For your References section:

    Highlighting the hidden: monitoring the avidity-driven association of a fluorescent GABARAP tandem with microtubules in living cells. Uffing A, Gold L, Gensch T, Weiergraber OH, Hoffmann S, Willbold D. Autophagy Rep. 2024 May 16;3(1):2348899. doi: 10.1080/27694127.2024.2348899. eCollection 2024. 10.1080/27694127.2024.2348899 PubMed 40395516