Skip to main content

pETSUMO2_Rhodoplanes-bGSDM
(Plasmid #212129)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212129 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETSUMO2
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 5932
  • Total vector size (bp) 6724
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Rhodoplanes bGSDM
  • Alt name
    Rhodoplanes bacterial gasdermin
  • Species
    Rhodoplanes sp. Z2-YC6860
  • Insert Size (bp)
    792
  • Mutation
    N-terminal methionine deleted and replaced by single serine scar after SUMO2 tag cleavage.
  • GenBank ID
    NZ_CP007440.1
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-SUMO2 (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACGGGCAACCAATCAATGAAACAG
  • 3′ sequencing primer TATGCTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETSUMO2_Rhodoplanes-bGSDM was a gift from Philip Kranzusch (Addgene plasmid # 212129 ; http://n2t.net/addgene:212129 ; RRID:Addgene_212129)
  • For your References section:

    Bacterial gasdermins reveal an ancient mechanism of cell death. Johnson AG, Wein T, Mayer ML, Duncan-Lowey B, Yirmiya E, Oppenheimer-Shaanan Y, Amitai G, Sorek R, Kranzusch PJ. Science. 2022 Jan 14;375(6577):221-225. doi: 10.1126/science.abj8432. Epub 2022 Jan 13. 10.1126/science.abj8432 PubMed 35025633