pETSUMO2_Rhodoplanes-bGSDM
(Plasmid
#212129)
-
PurposeFor expression of the bacterial gasdermin (bGSDM) encoded by a Rhodoplanes species. Protein is expressed with an N-terminal SUMO2 tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETSUMO2
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 5932
- Total vector size (bp) 6724
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRhodoplanes bGSDM
-
Alt nameRhodoplanes bacterial gasdermin
-
SpeciesRhodoplanes sp. Z2-YC6860
-
Insert Size (bp)792
-
MutationN-terminal methionine deleted and replaced by single serine scar after SUMO2 tag cleavage.
-
GenBank IDNZ_CP007440.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-SUMO2 (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACGGGCAACCAATCAATGAAACAG
- 3′ sequencing primer TATGCTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETSUMO2_Rhodoplanes-bGSDM was a gift from Philip Kranzusch (Addgene plasmid # 212129 ; http://n2t.net/addgene:212129 ; RRID:Addgene_212129) -
For your References section:
Bacterial gasdermins reveal an ancient mechanism of cell death. Johnson AG, Wein T, Mayer ML, Duncan-Lowey B, Yirmiya E, Oppenheimer-Shaanan Y, Amitai G, Sorek R, Kranzusch PJ. Science. 2022 Jan 14;375(6577):221-225. doi: 10.1126/science.abj8432. Epub 2022 Jan 13. 10.1126/science.abj8432 PubMed 35025633