INT_SS9sp
(Plasmid
#212145)
-
PurposeEffector plasmid for for operon integration into the genome (Safe Site 9) using CRISPR-Cas12a. Plasmid can be removed by incubating cells at 37 C.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSC101ts
-
Vector typeBacterial Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameVchTniQ, VchCas8, VchCas7, VchCas6, VchTnsA, VchTnsB, VchTnsC
-
gRNA/shRNA sequencetctggcgcagttgatatgtaaggcaggtttat
-
SpeciesVch genes: Vibrio cholerae
- Promoter pJ23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified from Addgene #160730
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
INT_SS9sp was a gift from Kang Zhou (Addgene plasmid # 212145 ; http://n2t.net/addgene:212145 ; RRID:Addgene_212145)