pET-AqpZ-ALFA
(Plasmid
#212310)
-
PurposeExpression of AqpZ with ALFA tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAquaporin Z
-
Alt nameAqpZ
-
SpeciesEscherichia coli
-
GenBank IDNC_000913.3
- Promoter T7
-
Tag
/ Fusion Protein
- ALFA tag and Strep-Tag II (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-AqpZ-ALFA was a gift from Arthur Laganowsky (Addgene plasmid # 212310 ; http://n2t.net/addgene:212310 ; RRID:Addgene_212310) -
For your References section:
Grafting the ALFA tag for structural studies of aquaporin Z. Stover L, Bahramimoghaddam H, Wang L, Schrecke S, Yadav GP, Zhou M, Laganowsky A. J Struct Biol X. 2024 Feb 2;9:100097. doi: 10.1016/j.yjsbx.2024.100097. eCollection 2024 Jun. 10.1016/j.yjsbx.2024.100097 PubMed 38361954