Skip to main content

pET-AqpZ-ALFA
(Plasmid #212310)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212310 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Aquaporin Z
  • Alt name
    AqpZ
  • Species
    Escherichia coli
  • GenBank ID
    NC_000913.3
  • Promoter T7
  • Tag / Fusion Protein
    • ALFA tag and Strep-Tag II (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-AqpZ-ALFA was a gift from Arthur Laganowsky (Addgene plasmid # 212310 ; http://n2t.net/addgene:212310 ; RRID:Addgene_212310)
  • For your References section:

    Grafting the ALFA tag for structural studies of aquaporin Z. Stover L, Bahramimoghaddam H, Wang L, Schrecke S, Yadav GP, Zhou M, Laganowsky A. J Struct Biol X. 2024 Feb 2;9:100097. doi: 10.1016/j.yjsbx.2024.100097. eCollection 2024 Jun. 10.1016/j.yjsbx.2024.100097 PubMed 38361954