pKJ221
(Plasmid
#212319)
-
PurposeExpress MmFnuc guide with pureexpress
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212319 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMercenaria guide
-
gRNA/shRNA sequenceGCAGCCACCTCCTTGTTATTG
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKJ221 was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 212319 ; http://n2t.net/addgene:212319 ; RRID:Addgene_212319) -
For your References section:
Programmable RNA-guided DNA endonucleases are widespread in eukaryotes and their viruses. Jiang K, Lim J, Sgrizzi S, Trinh M, Kayabolen A, Yutin N, Bao W, Kato K, Koonin EV, Gootenberg JS, Abudayyeh OO. Sci Adv. 2023 Sep 29;9(39):eadk0171. doi: 10.1126/sciadv.adk0171. Epub 2023 Sep 27. 10.1126/sciadv.adk0171 PubMed 37756409